
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mfn2
- Ensembl ID:
- ENSDARG00000079504
- ZFIN ID:
- ZDB-GENE-081105-44
- Description:
- mitofusin-2 [Source:RefSeq peptide;Acc:NP_001121726]
- Human Orthologue:
- MFN2
- Human Description:
- mitofusin 2 [Source:HGNC Symbol;Acc:16877]
- Mouse Orthologue:
- Mfn2
- Mouse Description:
- mitofusin 2 Gene [Source:MGI Symbol;Acc:MGI:2442230]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13351 | Essential Splice Site | Available for shipment | Available now |
hu3528 | Nonsense | Confirmed mutation in F2 line | Unknown |
sa21386 | Nonsense | Available for shipment | Available now |
sa34491 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13351
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108662 | Essential Splice Site | 104 | 757 | 2 | 17 |
ENSDART00000140266 | Essential Splice Site | 104 | 757 | 3 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 50073442)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 47925419 GRCz11 8 47914411 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGGKGAAGTCCTGTCCCGAAGACACATGAARGTGGTCTTCTTTGGCAGG[T/C]ACRGTGCATAGATTTTGCCCCTCACAGAATAAACGCAAACATATGTCAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- hu3528
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Unknown
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108662 | Nonsense | 285 | 757 | 7 | 17 |
ENSDART00000140266 | Nonsense | 285 | 757 | 8 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 50087109)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 47939086 GRCz11 8 47928078 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATGTTTTGTCAGGTGAGGCGGCAGCACATGGACCGCTGCACTAGTTTTT[T/A]AGTGGATGAGCTGCGGGTGGTGGATCGCTCTCATGCCGGGGATCGAATCT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa21386
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108662 | Nonsense | 615 | 757 | 14 | 17 |
ENSDART00000140266 | Nonsense | 615 | 757 | 15 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 50099220)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 47951197 GRCz11 8 47940189 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTTATGGTTTCTATGGTGACAGGACTGGCATCACTCACCTCTCGGACAT[C/A]AATGGGCATCATAGTTGTTGGAGGAGTGGTAAGAACACACTGGATATCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34491
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108662 | Nonsense | 752 | 757 | 17 | 17 |
ENSDART00000140266 | Nonsense | 752 | 757 | 18 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 50104863)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 47956840 GRCz11 8 47945832 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATAAGGCGGGCTGGCTGGACAGTGAGCTCAACATGTTCATTCAGCAGTA[T/A]CTTCAACAGGGGCGATAAACTCCACAAGCCCTCAACAAGCTCCGTCGATC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: