
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-149l1.2
- Ensembl ID:
- ENSDARG00000079501
- ZFIN ID:
- ZDB-GENE-090313-40
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JM07]
- Human Orthologue:
- C2orf55
- Human Description:
- chromosome 2 open reading frame 55 [Source:HGNC Symbol;Acc:33454]
- Mouse Orthologue:
- 2010300C02Rik
- Mouse Description:
- RIKEN cDNA 2010300C02 gene Gene [Source:MGI Symbol;Acc:MGI:1919347]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38293 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa19581 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa38293
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108523 | Essential Splice Site | 166 | 832 | 4 | 10 |
ENSDART00000136747 | None | 134 | None | 5 | |
ENSDART00000140824 | Essential Splice Site | 166 | 775 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 1 (position 50194880)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 49044061 GRCz11 1 49688481 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACCGGAAACCTACTTGTATGAGCGAGTGATGCATGGAGGCATTTACAAG[G/A]TTGCAGACTTTAACTTTGACCATTTGATTTGATTTGAGTTTAAACAAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19581
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108523 | Splice Site, Nonsense | 745 | 832 | 9 | 10 |
ENSDART00000136747 | None | 134 | None | 5 | |
ENSDART00000140824 | Splice Site, Nonsense | 745 | 775 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome 1 (position 50204416)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 49053597 GRCz11 1 49698017 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTAAGCTTTGATCCAAAAATATACATTAAAAGGAAATGTATTCTGTTAG[C/T]AGGACAACAGTAGGAACAATACCACCGAAGATGACACGACAAAGAGAACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: