LOC559291

Ensembl ID:
ENSDARG00000079453
Human Orthologue:
ATP8B4
Human Description:
ATPase, class I, type 8B, member 4 [Source:HGNC Symbol;Acc:13536]
Mouse Orthologue:
Atp8b4
Mouse Description:
ATPase, class I, type 8B, member 4 Gene [Source:MGI Symbol;Acc:MGI:1859664]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25234 Nonsense Mutation detected in F1 DNA During 2018
sa38115 Nonsense Available for shipment Available now
sa10509 Nonsense Available for shipment Available now
sa38114 Nonsense Mutation detected in F1 DNA During 2018
sa8931 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115343 Nonsense 19 1157 1 26
Genomic Location (Zv9):
Chromosome 25 (position 33427790)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32038192
GRCz11 25 32449149
KASP Assay ID:
554-7360.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACGTCATGTTCGAGCCAACGATCGGGACTACAACGAGAGATTCAGTTA[T/A]GCTGTGAGTCTCTAAATGTATTTAATTATGTAATGTAATGTGTGGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115343 Nonsense 148 1157 6 26
Genomic Location (Zv9):
Chromosome 25 (position 33419242)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32029644
GRCz11 25 32440601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCTTCTGACAGGCTGACCTTCTCCTCCTCTCTAGCAGTGAGCCCTA[T/A]GGACTGTGCTATATCGAGACTGCAGAGCTTGATGGGTGAGCTGTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115343 Nonsense 475 1157 13 26
Genomic Location (Zv9):
Chromosome 25 (position 33409741)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32020143
GRCz11 25 32431100
KASP Assay ID:
554-5491.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAATTCTTCCGTCTGTTAGCRCTCTGCCACACCGTCATGCCAGAAGAG[A/T]GAAACGAGGGTAATCTGGAGCACGAACACCCAAAACATCTTCATATTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115343 Nonsense 482 1157 14 26
Genomic Location (Zv9):
Chromosome 25 (position 33409634)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32020036
GRCz11 25 32430993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCACTGGAAACTGATCAGAATAAATTGTTGAAGGTGAGCTGGTGTA[T/A]CAGGCACAGTCTCCAGATGAAGGAGCCCTGGTTACTGCGGCTCGCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115343 Nonsense 957 1157 23 26
Genomic Location (Zv9):
Chromosome 25 (position 33392314)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32002716
GRCz11 25 32413673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTCTTCAACAAGAGGAAGTTTTTCACCTGTACRCTGCAGGGGGTCTA[C/A]ACCTCCTTCATCCTCTTCTTCATCCYGTATGGAGCCTTCATGCCAGCMGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link