zgc:153695

Ensembl ID:
ENSDARG00000079452
ZFIN ID:
ZDB-GENE-061013-298
Description:
Probable RNA-binding protein 46 [Source:UniProtKB/Swiss-Prot;Acc:Q08BH5]
Human Orthologue:
RBM46
Human Description:
RNA binding motif protein 46 [Source:HGNC Symbol;Acc:28401]
Mouse Orthologue:
Rbm46
Mouse Description:
RNA binding motif protein 46 Gene [Source:MGI Symbol;Acc:MGI:3645057]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10678 Nonsense Available for shipment Available now
sa30580 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110698 Nonsense 43 510 3 6
Genomic Location (Zv9):
Chromosome 1 (position 9306934)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9446720
GRCz11 1 10130831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAWTAACACACTGAAGTTGTGTTTCAGGCTGGGAGGGCCCTCCTCCTCCA[C/T]GAGGTTGTGAGGTGTTTGTGGGTAAAATCCCGAGAGAYATGTATGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110698 Nonsense 338 510 5 6
Genomic Location (Zv9):
Chromosome 1 (position 9309756)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9449542
GRCz11 1 10133653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTTCCAGACCAGAAATGACATGACCATCGGAGCTATGGGCAATGGGT[T/A]AAACGCACACGCTCTCAGCCTGCCATATGCAGTGGACTTAGATCGCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link