wu:fc03h05

Ensembl ID:
ENSDARG00000079451
ZFIN IDs:
ZDB-GENE-030131-2308, ZDB-GENE-030131-2308
Human Orthologue:
PIK3R5
Human Description:
phosphoinositide-3-kinase, regulatory subunit 5 [Source:HGNC Symbol;Acc:30035]
Mouse Orthologue:
Pik3r5
Mouse Description:
phosphoinositide-3-kinase, regulatory subunit 5, p101 Gene [Source:MGI Symbol;Acc:MGI:2443588]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40662 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108920 Nonsense 808 870 18 19
ENSDART00000126371 Nonsense 808 870 18 19
Genomic Location (Zv9):
Chromosome 6 (position 17949449)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23504833
GRCz11 6 19976154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGATAAGGTTCAGGTTAGTGGAACTTGCAACACCACCTTCGCAGTTTG[T/A]CTGGACCAAGATGAGAAGAAAATTTTACAGAGTGTGATGAGGTAAAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link