zgc:174895

Ensembl ID:
ENSDARG00000079416
ZFIN IDs:
ZDB-GENE-070928-41, ZDB-GENE-070928-41
Description:
hypothetical protein LOC100126024 [Source:RefSeq peptide;Acc:NP_001099174]
Human Orthologue:
APRT
Human Description:
adenine phosphoribosyltransferase [Source:HGNC Symbol;Acc:626]
Mouse Orthologue:
Aprt
Mouse Description:
adenine phosphoribosyl transferase Gene [Source:MGI Symbol;Acc:MGI:88061]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35831 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42509 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109004 Essential Splice Site 73 200 3 5
ENSDART00000128081 Essential Splice Site 73 200 3 6
Genomic Location (Zv9):
Chromosome 15 (position 14476560)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15521523
GRCz11 15 15457545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAATTCACTAAAAATCATATTTATTTAAAACTTCCTCCTGCAATTTC[A/T]GGGTCAGCTGTAGCCACAACATTGGGAAAAGGATTTCTGGCTATTCGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109004 Nonsense 174 200 5 5
ENSDART00000128081 Nonsense 174 200 5 6
Genomic Location (Zv9):
Chromosome 15 (position 14478219)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15523182
GRCz11 15 15459204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGCCATTGAAAACAGTGAAGGAGGAAAATGGCTGAAGGAAAACTAT[A/T]AATATTCCCACTGCATTCCGAAAGAGCTGCAATCTCAAATAGACAGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link