zgc:162213

Ensembl ID:
ENSDARG00000079397
ZFIN ID:
ZDB-GENE-070410-38
Description:
ceramide kinase-like protein [Source:RefSeq peptide;Acc:NP_001082943]
Human Orthologue:
CERKL
Human Description:
ceramide kinase-like [Source:HGNC Symbol;Acc:21699]
Mouse Orthologue:
Cerkl
Mouse Description:
ceramide kinase-like Gene [Source:MGI Symbol;Acc:MGI:3037816]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45378 Nonsense Mutation detected in F1 DNA During 2018
sa15401 Nonsense Available for shipment Available now
sa41544 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41543 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110411 Nonsense 62 577 1 13
ENSDART00000147279 Nonsense 62 302 1 5
Genomic Location (Zv9):
Chromosome 9 (position 45355301)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44487622
GRCz11 9 44289364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGAAGCAAAGTCAGAAGCGCTCCGTTTCGGCCCCTCAGTTATGCCCC[G/T]AAGAAGACTACAAGGAGCGAGTAGAAACTAAATACAGACCGGACGAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110411   180 577 2 13
ENSDART00000147279 Nonsense 180 302 2 5
Genomic Location (Zv9):
Chromosome 9 (position 45315738)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44448059
GRCz11 9 44249801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RATCATGCCATCCATCTCAACAACCTGAGCGTGGACCACTGTGAGATCTG[G/A]TTCAAAACCCTCAAAGAGCTCCTCAACGGTACGTTCACATCMCAGCAGWT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110411 Essential Splice Site 387 577 7 13
ENSDART00000147279   None 302 None 5
Genomic Location (Zv9):
Chromosome 9 (position 45175448)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44307769
GRCz11 9 44109511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGCCAGCGCCGCGAGTTCGCTCTCATTAAAACACTGGCAAAGCTCAA[G/A]TAAGCGCTCTCTCTTTCTCAGTTGTGTTGTCAGCTGTAGCTGTCTCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110411 Essential Splice Site 551 577 13 13
ENSDART00000147279   None 302 None 5
Genomic Location (Zv9):
Chromosome 9 (position 45160551)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44292872
GRCz11 9 44094614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAAATCTGTGTAATGTTTAAATGTCCTGACAGAAGTGTTTATTTTCC[A/T]GAGTTCACCCTCAGCTCCTCACACTCTTTGGATCAGACGTGGAGGAGGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link