si:dkeyp-23e4.2

Ensembl ID:
ENSDARG00000079393
ZFIN ID:
ZDB-GENE-091204-83
Human Orthologue:
TMPRSS15
Human Description:
transmembrane protease, serine 15 [Source:HGNC Symbol;Acc:9490]
Mouse Orthologue:
Tmprss15
Mouse Description:
transmembrane protease, serine 15 Gene [Source:MGI Symbol;Acc:MGI:1197523]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9354 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19267 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9728 Nonsense Available for shipment Available now
sa39340 Nonsense Mutation detected in F1 DNA During 2018
sa44974 Nonsense Mutation detected in F1 DNA During 2018
sa23996 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109041 Essential Splice Site 178 1045 6 27
ENSDART00000135400   None 934 None 24
ENSDART00000109041 Essential Splice Site 178 1045 6 27
ENSDART00000135400   None 934 None 24
Genomic Location (Zv9):
Chromosome 21 (position 33969333)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34969026
GRCz11 21 35003516
KASP Assay ID:
2261-5892.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAYTGCTTGGAACTGNNACACTCATGGGCAGTGYTGCAYATAAAAGTTAAAG[T/C]TAWTTTAATTTGATATGATTTCTAAAAAATCCCAGTGCTTCAAATGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109041 Essential Splice Site 178 1045 6 27
ENSDART00000135400   None 934 None 24
ENSDART00000109041 Essential Splice Site 178 1045 6 27
ENSDART00000135400   None 934 None 24
Genomic Location (Zv9):
Chromosome 21 (position 33969333)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34969026
GRCz11 21 35003516
KASP Assay ID:
2261-5892.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGCTTGGAACTGACACTCATGGGCAGTGTTGCATATAAAAGTTAAAG[T/C]TATTTTAATTTGATATGATTTCTAAAAAATCCCAGTGCTTCAAATGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109041 Nonsense 241 1045 9 27
ENSDART00000135400 Nonsense 140 934 6 24
Genomic Location (Zv9):
Chromosome 21 (position 33975504)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34975197
GRCz11 21 35009687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATATATGATGTTTCCTTTATGRCCTAYAGCAACAGWGTGTGATGGA[C/T]AGTTTCTCTTGCTTGGTTYATCCGGATCCTTCCACTCAAAAAACTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109041 Nonsense 552 1045 16 27
ENSDART00000135400 Nonsense 444 934 13 24
Genomic Location (Zv9):
Chromosome 21 (position 33985505)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34985198
GRCz11 21 35019688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCCTTTGACCTGTATGAACCAAACTCGACGTTCAGCTCTCCAAACTA[C/A]CCAGATGGTTACGGACATAATGCTTCATGTGGGTATTTAATAGATACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109041 Nonsense 700 1045 20 27
ENSDART00000135400 Nonsense 587 934 17 24
Genomic Location (Zv9):
Chromosome 21 (position 33991392)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34991085
GRCz11 21 35025575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTGTATTTTAGTGCATGTAATAAAAGATAACACCACTGGAACTGAA[C/T]GACTGAAACTTCGAATCCAGAATAATTTATACACGGTGTGTGCTCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109041 Nonsense 908 1045 24 27
ENSDART00000135400 Nonsense 795 934 21 24
Genomic Location (Zv9):
Chromosome 21 (position 34001536)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35001229
GRCz11 21 35035719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGGAATCTGACTTTGCTCTAATGCATTTAAAGACACCTGTCAGCTA[C/A]ACAGGTACGGAAATAACATTTGATTCTTCAGTTTTATTGACTATACTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link