zgc:174153

Ensembl ID:
ENSDARG00000079376
ZFIN ID:
ZDB-GENE-080215-7
Description:
hypothetical protein LOC567623 [Source:RefSeq peptide;Acc:NP_001104662]
Human Orthologues:
CTSL1, CTSL2
Human Descriptions:
cathepsin L1 [Source:HGNC Symbol;Acc:2537]
cathepsin L2 [Source:HGNC Symbol;Acc:2538]
Mouse Orthologues:
4930486L24Rik, BC051665, Cts3, Cts6, Cts7, Cts8, Ctsj, Ctsl, Ctsll3, Ctsm, Ctsq, Ctsr
Mouse Descriptions:
cathepsin 3 Gene [Source:MGI Symbol;Acc:MGI:2151929]
cathepsin 6 Gene [Source:MGI Symbol;Acc:MGI:1889619]
cathepsin 7 Gene [Source:MGI Symbol;Acc:MGI:1860262]
cathepsin 8 Gene [Source:MGI Symbol;Acc:MGI:1860275]
cathepsin J Gene [Source:MGI Symbol;Acc:MGI:1349426]
cathepsin L Gene [Source:MGI Symbol;Acc:MGI:88564]
cathepsin L-like 3 Gene [Source:MGI Symbol;Acc:MGI:1917452]
cathepsin M Gene [Source:MGI Symbol;Acc:MGI:1927229]
cathepsin Q Gene [Source:MGI Symbol;Acc:MGI:2137385]
cathepsin R Gene [Source:MGI Symbol;Acc:MGI:1861723]
cDNA sequence BC051665 Gene [Source:MGI Symbol;Acc:MGI:2682300]
RIKEN cDNA 4930486L24 gene Gene [Source:MGI Symbol;Acc:MGI:1922258]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27927 Nonsense Mutation detected in F1 DNA During 2018
sa2650 Nonsense F2 line generated During 2018
sa5599 Nonsense F2 line generated During 2018
sa45457 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113654 Nonsense 190 336 5 8
Genomic Location (Zv9):
Chromosome 12 (position 18017776)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16828950
GRCz11 12 16950824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGCAATCAAGGGTGTAATGGAGGCCTCATGGACCAGGCCTTCCAGTA[T/A]GTTAAAGAAAACAAGGGGCTGGATTCTGAGCAGTCATACCCTTATCTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2650
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113654 Nonsense 262 336 6 8
ENSDART00000113654 Nonsense 262 336 6 8
Genomic Location (Zv9):
Chromosome 12 (position 18018181)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16829355
GRCz11 12 16951229
KASP Assay ID:
554-3155.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCTGTATCTGTTGCTATTGACGCATCACATCAATCCCTACAGTTCTA[T/G]CAGTCTGGTAGGTGTCTGATATCCCTCAACTCTAGTTTTAATTCAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5599
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113654 Nonsense 262 336 6 8
ENSDART00000113654 Nonsense 262 336 6 8
Genomic Location (Zv9):
Chromosome 12 (position 18018181)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16829355
GRCz11 12 16951229
KASP Assay ID:
554-3155.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCTGTATCTGTTGCTATTGACGCATCACATCAATCCCTACAGTTCTA[T/G]CAGTCTGGTAGGTGTCTGATATCCCTCAACTCTAGTTTTAATTCAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113654 Essential Splice Site 304 336 8 8
Genomic Location (Zv9):
Chromosome 12 (position 18018514)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16829688
GRCz11 12 16951562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCTTGATTGCATGTTTTCATATTTTATTATTTCTTTCAATTTTTTT[A/G]GCTGGTCTGACAAATGGGGTGACAAAGGCTACATCTACATGGCAAAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link