si:dkey-33l14.1

Ensembl ID:
ENSDARG00000079374
ZFIN ID:
ZDB-GENE-090313-308
Human Orthologue:
TJP1
Human Description:
tight junction protein 1 (zona occludens 1) [Source:HGNC Symbol;Acc:11827]
Mouse Orthologue:
Tjp1
Mouse Description:
tight junction protein 1 Gene [Source:MGI Symbol;Acc:MGI:98759]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44339 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15532 Nonsense Available for shipment Available now
sa13104 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112588 Essential Splice Site 528 1689 12 27
ENSDART00000139840   None 361 None 8
Genomic Location (Zv9):
Chromosome 25 (position 33215775)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31826378
GRCz11 25 32237339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCAAAGGAGAGGAGGTCACCATCCTGGCCCAGAAGAAGAAAGACG[G/A]TGAGGAGATGATTTGTCAATGCTTAAAGGGATAACCAAAACCTAATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112588 Nonsense 635 1689 14 27
ENSDART00000139840   None 361 None 8
Genomic Location (Zv9):
Chromosome 25 (position 33218101)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31828704
GRCz11 25 32239665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGGATCGCGCCGACTTCTGGAGATTCAGAGGCCTCCGCAGCTCCAAR[C/T]GAAACCTGAGGAAGAGCAGAGARGACCTGTCTGCTCAGCCGGTCCAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112588 Nonsense 1310 1689 22 27
ENSDART00000139840   None 361 None 8
Genomic Location (Zv9):
Chromosome 25 (position 33236071)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31846674
GRCz11 25 32257635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAACCTCAGACGCGTGTTGGGGACGATGTGGTTCGCTCCAACCACTA[C/A]GACCCTGATGATGATGAAGAGTACTACAGAAAACAGCWMTCRTTTTTCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link