AKAP13 (2 of 2)

Ensembl ID:
ENSDARG00000079358
Description:
A kinase (PRKA) anchor protein 13 [Source:HGNC Symbol;Acc:371]
Human Orthologue:
AKAP13
Human Description:
A kinase (PRKA) anchor protein 13 [Source:HGNC Symbol;Acc:371]
Mouse Orthologue:
Akap13
Mouse Description:
A kinase (PRKA) anchor protein 13 Gene [Source:MGI Symbol;Acc:MGI:2676556]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34019 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038430 Essential Splice Site 244 695 5 14
Genomic Location (Zv9):
Chromosome 7 (position 15714415)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14861413
GRCz11 7 15109700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGCGCAACACCTGGATGCAGATCATTCAGGATGCCATGCACTCCATG[T/C]GAGTAAGACACTTTCACATCCACTGCTGGTCAATGGAGAAGCCAAAAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link