
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sc:d158
- Ensembl ID:
- ENSDARG00000079353
- ZFIN ID:
- ZDB-GENE-080303-7
- Description:
- hypothetical protein LOC100142635 [Source:RefSeq peptide;Acc:NP_001116085]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15567 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15567
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111758 | Nonsense | 190 | 213 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 3 (position 34674806)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 34460002 GRCz11 3 34589510 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGGTTAATGATCTTTTTTNCTGTTTTACCCCAGATTAAGAAGATGAGA[C/T]AAACCGCTRAACAGGAAAAAACGTCTGCAAATGAAGTGTACGAGGTCATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: