si:dkeyp-8h3.5

Ensembl ID:
ENSDARG00000079350
ZFIN ID:
ZDB-GENE-030131-1423
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIH9]
Human Orthologues:
RP11-159G9.5, ZNF654
Human Descriptions:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JYP6]
zinc finger protein 654 [Source:HGNC Symbol;Acc:25612]
Mouse Orthologue:
Zfp654
Mouse Description:
zinc finger protein 654 Gene [Source:MGI Symbol;Acc:MGI:1919270]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9791 Nonsense Available for shipment Available now
sa31213 Nonsense Available for shipment Available now
sa17903 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114384 Nonsense 413 1614 8 9
ENSDART00000147703   None 304 8 9
Genomic Location (Zv9):
Chromosome 1 (position 33288474)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32923225
GRCz11 1 33655793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTGATCAACAGTACYATGTAGACACTGGTCTTGTRGGCAACAGTGTA[C/T]GATTTGAGGTTCTCCAGATCCTTAAAAAAGACCTGTATTTTGACCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114384 Nonsense 727 1614 8 9
ENSDART00000147703   None 304 8 9
Genomic Location (Zv9):
Chromosome 1 (position 33289416)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32924167
GRCz11 1 33656735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATTCAAGACCTGTTGAATTAGAAAAAATATCATTCAACAGTTTACCC[A/T]GAGAGCAAGAAGCTAAGCTGAACCATAATGAATCCAAAGAAGAAAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114384 Nonsense 756 1614 8 9
ENSDART00000147703   None 304 8 9
Genomic Location (Zv9):
Chromosome 1 (position 33289503)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32924254
GRCz11 1 33656822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WAGAAGAAAGTGTGGYTACAGAGCAACTGTGTGAACCTGCAGAGAGCCCT[G/T]AAGTTGTTRAACATGTTAAACAGTCTGTCGAAATTAAGTCTACACCAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link