zgc:163067

Ensembl ID:
ENSDARG00000079329
ZFIN ID:
ZDB-GENE-070410-134
Description:
E3 ubiquitin-protein ligase RFWD2 [Source:RefSeq peptide;Acc:NP_001083011]
Human Orthologue:
RFWD2
Human Description:
ring finger and WD repeat domain 2 [Source:HGNC Symbol;Acc:17440]
Mouse Orthologue:
Rfwd2
Mouse Description:
ring finger and WD repeat domain 2 Gene [Source:MGI Symbol;Acc:MGI:1347046]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19809 Nonsense Available for shipment Available now
sa18235 Essential Splice Site Available for shipment Available now
sa10199 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113609 Nonsense 334 694 10 20

The following transcripts of ENSDARG00000079329 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 34843422)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35140132
GRCz11 2 35122589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACGGCGGAAGAGACTGACGGCACACTTTGAGGATCTGGAACAGTGTTA[T/A]TTTTCCAATAGGATGTCTCGAATAACGGGTCAGCTGATTCAAAGTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113609 Essential Splice Site 579 694 16 20

The following transcripts of ENSDARG00000079329 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 34849829)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35146539
GRCz11 2 35128996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCRGWATCCTATGCCAAGTTTGTCAATGGAGAAGAAATTGTCTCTGC[G/A]TAWGTATACACTCAAAGTCCTTGTGTTTTTTTTTTTTTTCCTTTATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113609 Essential Splice Site 689 694 19 20

The following transcripts of ENSDARG00000079329 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 34857570)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35154280
GRCz11 2 35136737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGGAGTCAAATGTGTTGATTGCAGCCAACAGTCAAGGAACAATCAAG[G/A]TGAGTTGTGGTGCAAAACAAGCTAAACAGCAAYACAAAAGTCAATATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link