hmcn2
- Ensembl ID:
- ENSDARG00000079327
- ZFIN ID:
- ZDB-GENE-030131-9765
- Human Orthologues:
- HMCN2, RP11-88G17.6
- Human Descriptions:
- hemicentin 2 [Source:HGNC Symbol;Acc:21293]
- Novel protein similar to hemicentin (LOC392395) [Source:UniProtKB/TrEMBL;Acc:A2A3K3]
- Mouse Orthologue:
- Hmcn2
- Mouse Description:
- hemicentin 2 Gene [Source:MGI Symbol;Acc:MGI:2677838]
Alleles
There are 8 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa31666 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa34441 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa44691 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41253 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa7144 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa27237 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa34442 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa16664 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa31666
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 33557218)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
32699944 |
GRCz11 |
8 |
32709176 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGCAGGTGTTGAGGGTTAAGTCTGTCAGGCCTAGGGATCGTGGCCTGTA[T/G]CAGTGTGTGGCGACAAACAACGCTGGGACTCAGACAAGACAGTTCAGGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34441
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 33557280)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
32700006 |
GRCz11 |
8 |
32709238 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACAAACAACGCTGGGACTCAGACAAGACAGTTCAGGCTGACCATACAAG[G/A]TAAGCCATTGGGATGGAACTAATAATGAATTCTAGTCTCCACATTCCCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44691
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 33559841)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
32702567 |
GRCz11 |
8 |
32711799 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATACACCTGCCGAGCAACCAATCCGGCTGGAACAGCACATAGACATTA[C/A]ACACTAAGAATTATGGGTAAATAGGCTTGCAAGATAACCTGATTTATATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41253
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 33565407)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
32708133 |
GRCz11 |
8 |
32717365 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGATGGAGCCAGTTATCAGTGTGTGGCAGAGAATAAAGCTGGAGCTGTC[G/T]AGAGACTTTACAGCTTGTCTATTCAAGGTAAGAGCAACTGACAGAGTTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7144
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 33595703)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
32738429 |
GRCz11 |
8 |
32747661 |
- KASP Assay ID:
- 554-4587.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGTTTTCACGTGTTACTCTTGGAGATGCAGGAACATATCAGTGTTTAGCA[C/T]AGAATGAAGCAGGAACAGCTTTGGCACAAACCCAGCTTATAKTRCAAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27237
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 33605729)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
32748455 |
GRCz11 |
8 |
32757687 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAATGGATTTGTTCCTCCTATGCTTTTGTCCTCTAATCTCAATCTACAGG[T/G]AAGTTTTTCAAACTCAAATGTGTAAAGTAAATCTCAGCAGGCATTACTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34442
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 33606670)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
32749396 |
GRCz11 |
8 |
32758628 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGAGTCGTATGTGCAGACAGGCTCTGGGCAGCTTTATTCCTGGTCCACA[C/T]AGAATCACATTCGGGACGGGGCTCCTCTTACCCTGCGCTGCAATCATACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16664
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 33632787)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
32775513 |
GRCz11 |
8 |
32784745 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGCCATTTGGCATCAAGGATGAAGCAGGAAGAGGCATCATTTTCACAGTR[A/T]AGCCTTTAGACTGGCCAGGCCTGGTGCGACTTSGGGTACAAGCCACAACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: