si:rp71-15d4.1

Ensembl ID:
ENSDARG00000079315
ZFIN ID:
ZDB-GENE-081105-159
Description:
Novel protein similar to vertebrate leupaxin (LPXN) [Source:UniProtKB/TrEMBL;Acc:B0S7N1]
Human Orthologue:
LPXN
Human Description:
leupaxin [Source:HGNC Symbol;Acc:14061]
Mouse Orthologue:
Lpxn
Mouse Description:
leupaxin Gene [Source:MGI Symbol;Acc:MGI:2147677]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44682 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109209 Nonsense 28 405 2 9
ENSDART00000139647 Nonsense 39 416 2 9
Genomic Location (Zv9):
Chromosome 8 (position 20513024)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19942921
GRCz11 8 19975006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTCAAAACTCCAGCGAGGCTTCAGACCCTCCTGTGCTCCTTCCAGCC[A/T]AAACCCTGAAAAACAACAACACAACTGTGCTCCAACAAGTACAGTACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link