si:ch211-198n5.8

Ensembl ID:
ENSDARG00000079308
ZFIN ID:
ZDB-GENE-081104-165
Description:
torsin-3A [Source:RefSeq peptide;Acc:NP_001121738]
Human Orthologue:
TOR3A
Human Description:
torsin family 3, member A [Source:HGNC Symbol;Acc:11997]
Mouse Orthologue:
Tor3a
Mouse Description:
torsin family 3, member A Gene [Source:MGI Symbol;Acc:MGI:1353652]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45317 Nonsense Mutation detected in F1 DNA During 2018
sa21235 Nonsense Available for shipment Available now
sa41161 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102556 Nonsense 41 367 1 6
Genomic Location (Zv9):
Chromosome 8 (position 17128175)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16573063
GRCz11 8 16608775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCAATGTTTCTACCTATTATTTCAATTACCTCTATTGCAATATTTG[G/A]GAAGGAGACTGTCAACCACATCAGGATGACGCGACTCAACAAGGTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102556 Nonsense 54 367 1 6
Genomic Location (Zv9):
Chromosome 8 (position 17128138)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16573026
GRCz11 8 16608738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAATATTTGGGAAGGAGACTGTCAACCACATCAGGATGACGCGACT[C/T]AACAAGGTAAATATAAGTAAGATGGATACTGACAGATGGTGATTTCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102556 Nonsense 290 367 6 6
Genomic Location (Zv9):
Chromosome 8 (position 17117592)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16562480
GRCz11 8 16598192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGATATTCCTCACTAAGCATCTGTTCACCTTTGCAGGAGGTTTTGCA[C/T]AGAGCGAGCTGATGTCAGGCCATCTGATTGACTTCTTTGTACCGTTCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link