LOC100334474

Ensembl ID:
ENSDARG00000079292
Human Orthologues:
SAMD9, SAMD9L
Human Descriptions:
sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
sterile alpha motif domain containing 9-like [Source:HGNC Symbol;Acc:1349]
Mouse Orthologue:
Samd9l
Mouse Description:
sterile alpha motif domain containing 9-like Gene [Source:MGI Symbol;Acc:MGI:1343184]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6877 Nonsense Mutation detected in F1 DNA During 2018
sa45127 Nonsense Mutation detected in F1 DNA During 2018
sa33084 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108630 Nonsense 438 954 1 3
Genomic Location (Zv9):
Chromosome 3 (position 6850978)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6674672
GRCz11 3 6560512
KASP Assay ID:
554-4830.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACATTCTGCTTACAACWGAKTTATTTTAYGAGTACACTCTGGGAAAA[C/T]AAAAATTAATGCAGGATGTTCACARCATGTTGGTGAGGAGGCAGAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108630 Nonsense 520 954 1 3
Genomic Location (Zv9):
Chromosome 3 (position 6851224)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6674426
GRCz11 3 6560266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTAAGAAACAAGACTTTAGTATGGCCAAGGATTGGGCAAAGAAAGCC[A/T]AAGACCTTTCAGGGGAGAACTCATACATGTGTGATACAGTATCACAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108630 Nonsense 634 954 1 3
Genomic Location (Zv9):
Chromosome 3 (position 6851566)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6674084
GRCz11 3 6559924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACACCACCGTATAAATCACAGTCAGAGCTAGCGGGATCAAACACAAAA[C/T]AGTCGACTGATGCAGAGAGTGAGCCATATTACCAAGTACTGGGGAGGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link