zgc:174877

Ensembl ID:
ENSDARG00000079278
ZFIN ID:
ZDB-GENE-041008-66
Description:
hypothetical protein LOC570025 [Source:RefSeq peptide;Acc:NP_001107091]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37821 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108994 Essential Splice Site 347 551 None 5
ENSDART00000130340 Essential Splice Site 347 552 None 6

The following transcripts of ENSDARG00000079278 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 6427834)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6315126
GRCz11 24 6344455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGACTGAACGAACCGAGGGAGATCATGGCAGTTTGTTTACAAAGG[T/G]ACTGGTAATAATAGTGGCTTTGCTTGTAAACAGAGGACTTTGCACTGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link