
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:66382
- Ensembl ID:
- ENSDARG00000079274
- ZFIN ID:
- ZDB-GENE-030131-1173
- Description:
- hypothetical protein LOC322453 [Source:RefSeq peptide;Acc:NP_955899]
- Human Orthologues:
- PRSS1, PRSS3, PRSS37, U66059.56
- Human Descriptions:
- protease, serine, 1 (trypsin 1) [Source:HGNC Symbol;Acc:9475]
- protease, serine, 3 [Source:HGNC Symbol;Acc:9486]
- protease, serine, 37 [Source:HGNC Symbol;Acc:29211]
- Trypsin-X3 [Source:UniProtKB/Swiss-Prot;Acc:Q8IYP2]
- Mouse Orthologues:
- 1700074P13Rik, 1810009J06Rik, 2210010C04Rik, AC161768.1, BC048599, Gm10334, Gm4744, Gm5771, Prss1, Prss2, Prss3, Prss37, Try10, Try4, Try5
- Mouse Descriptions:
- cDNA sequence BC048599 Gene [Source:MGI Symbol;Acc:MGI:3608323]
- predicted gene 10334 Gene [Source:MGI Symbol;Acc:MGI:3641889]
- predicted gene 4744 Pseudogene [Source:MGI Symbol;Acc:MGI:3643181]
- predicted gene 5771 Gene [Source:MGI Symbol;Acc:MGI:3646222]
- protease, serine, 1 (trypsin 1) Gene [Source:MGI Symbol;Acc:MGI:98839]
- protease, serine, 2 Gene [Source:MGI Symbol;Acc:MGI:102759]
- protease, serine, 3 Gene [Source:MGI Symbol;Acc:MGI:102758]
- protease, serine, 37 Gene [Source:MGI Symbol;Acc:MGI:1914940]
- RIKEN cDNA 1700074P13 gene Gene [Source:MGI Symbol;Acc:MGI:1920731]
- RIKEN cDNA 1810009J06 gene Gene [Source:MGI Symbol;Acc:MGI:1920876]
- RIKEN cDNA 2210010C04 gene Gene [Source:MGI Symbol;Acc:MGI:1914623]
- trypsin 10 Gene [Source:MGI Symbol;Acc:MGI:3687012]
- trypsin 4 Gene [Source:MGI Symbol;Acc:MGI:102757]
- trypsin 5 Gene [Source:MGI Symbol;Acc:MGI:102756]
- trypsinogen 4 [Source:RefSeq peptide;Acc:NP_001096130]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36141 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36142 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36141
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109136 | Nonsense | 171 | 242 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 28253802)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 26139923 GRCz11 16 26013365 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTGTTTGGAGATCCCCATCCTGTCTGACCGCGACTGTAACAACTCCTA[C/A]CCCGGCATGATTACCGACACCATGTTCTGCGCTGGATACCTGGAGGGAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36142
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109136 | Nonsense | 192 | 242 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 28253865)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 26139986 GRCz11 16 26013428 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCGACACCATGTTCTGCGCTGGATACCTGGAGGGAGGAAAAGACTCTTG[T/A]CAGGTAAAGAACAGCATGAAATGCTGCTGAAATACAAATATCAACTGAGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Pancreatitis: Common genetic variants in the CLDN2 and PRSS1-PRSS2 loci alter risk for alcohol-related and sporadic pancreatitis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: