zgc:175133

Ensembl ID:
ENSDARG00000079252
ZFIN ID:
ZDB-GENE-080515-7
Description:
hypothetical protein LOC100151756 [Source:RefSeq peptide;Acc:NP_001120943]
Human Orthologue:
FAM117A
Human Description:
family with sequence similarity 117, member A [Source:HGNC Symbol;Acc:24179]
Mouse Orthologue:
Fam117a
Mouse Description:
family with sequence similarity 117, memberA Gene [Source:MGI Symbol;Acc:MGI:2144564]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22042 Nonsense Available for shipment Available now
sa44751 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110458 Nonsense 128 339 4 8
Genomic Location (Zv9):
Chromosome 12 (position 10838114)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9825536
GRCz11 12 9863379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGTAAAATGTTCTGTTTTTGTTTCCAAGTTATCCAAGCAGAAACAA[C/T]AACTGCAACAGAAGCAACGGTCAGGAGTTCCAGTTGGCAGCAAAGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110458 Nonsense 288 339 8 8
Genomic Location (Zv9):
Chromosome 12 (position 10849767)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9837189
GRCz11 12 9875032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCTCCCTTTTTTTCCAATTCAGCCCTTCATGTTTGGAGCAAGTGTG[C/A]ATGTCTTCCTGCCCCGACCCCAACAAAGTGAACTTCACCACACACACGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link