si:dkey-22o22.2

Ensembl ID:
ENSDARG00000079247
ZFIN ID:
ZDB-GENE-100922-84
Human Orthologue:
FAT4
Human Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Mouse Orthologue:
Fat4
Mouse Description:
FAT tumor suppressor homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045256]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36223 Nonsense Mutation detected in F1 DNA During 2018
sa16390 Nonsense Available for shipment Available now
sa36222 Nonsense Mutation detected in F1 DNA During 2018
sa15888 Nonsense Available for shipment Available now
sa16692 Nonsense Available for shipment Available now
sa13663 Nonsense Available for shipment Available now
sa22920 Nonsense Available for shipment Available now
sa42791 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111951 Nonsense 347 2780 3 33
ENSDART00000146565 Nonsense 117 2395 2 31
Genomic Location (Zv9):
Chromosome 16 (position 43377743)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40762136
GRCz11 16 40712168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGGGCAGGAGGGGTACACACGCCTCTCTCTTCATTCTGGCCGGCTTT[C/T]GACCCCCTCAGTTCACCAACACCACCTACACCATCCACATCCCAGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111951 Nonsense 1037 2780 15 33
ENSDART00000146565 Nonsense 807 2395 14 31
Genomic Location (Zv9):
Chromosome 16 (position 43308955)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40693348
GRCz11 16 40643380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWTCTGAAGGACCAAAGCGGTGACTCGCAGTTCTTCAGCATTAATTCCTA[C/A]ACAGGCATCATCCACACGCGGGCCACCTTCGACCGTGAGCAGAAAGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111951 Nonsense 1179 2780 17 33
ENSDART00000146565 Nonsense 949 2395 16 31
Genomic Location (Zv9):
Chromosome 16 (position 43300337)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40684730
GRCz11 16 40634762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGGTGCAGCGCTACGAGTTACGGCTGGTTGCGTCGGATGGAAAGTG[G/A]GAAAACCAAACAATGGTCGTCATTAATGTCATCAACCAGAATGATGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111951 Nonsense 1784 2780 19 33
ENSDART00000146565 Nonsense 1554 2395 18 31
Genomic Location (Zv9):
Chromosome 16 (position 43295399)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40679792
GRCz11 16 40629824
KASP Assay ID:
2261-0165.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGACAGGTTCAATCCCCTGACCTTGATGACTGGAGCGAGAAGGTTTA[C/A]AAGTTCGAAGGCAAACCCCCCAGGTGCTTTGATCTTCTATTGAAGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111951 Nonsense 2051 2780 23 33
ENSDART00000146565 Nonsense 1821 2395 22 31
Genomic Location (Zv9):
Chromosome 16 (position 43282571)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40666964
GRCz11 16 40616996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAATGCCAGCAAACCAAACACAGCTTTCTTGGCAACGGCTATGCTTG[G/A]TTCCATCCCATAMARCCGTGCTTCCAGAGCCACATCTCTCTGGAGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111951 Nonsense 2076 2780 23 33
ENSDART00000146565 Nonsense 1846 2395 22 31
Genomic Location (Zv9):
Chromosome 16 (position 43282497)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40666890
GRCz11 16 40616922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAGCCACATCTCTCTGGAGTTCATCACGGAGGCAGCCAATGGCCTGY[T/A]GTTCTACAACGGCCCAATGGGAGCACCTCAGCCCAGAGAAAAAGAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111951 Nonsense 2393 2780 29 33
ENSDART00000146565 Nonsense 2163 2395 28 31
Genomic Location (Zv9):
Chromosome 16 (position 43272316)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40656709
GRCz11 16 40606741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGGCATGACAACATCTTCATCCTGCGACTGGAGCAGGGCGGAGGCTCA[C/T]GAGAGGTGACAGGGGTCCTGGGACAGAAGAAGGAAATTGTAGTTCACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111951 Essential Splice Site 2626 2780 33 33
ENSDART00000146565   None 2395 None 31
Genomic Location (Zv9):
Chromosome 16 (position 43260149)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40644564
GRCz11 16 40594596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCAAACAGGAGCTCTTCTGATGCACTTTTCTGAATGTTAAACCCACA[G/T]AACGCGTATGACATCACTGAGCTGAAGAGGCCGCTGTGTTCCAGCTTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link