zgc:175274

Ensembl ID:
ENSDARG00000079244
ZFIN ID:
ZDB-GENE-080204-94
Description:
phosphatidylinositol-glycan biosynthesis class W protein [Source:RefSeq peptide;Acc:NP_001108044]
Human Orthologue:
PIGW
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class W [Source:HGNC Symbol;Acc:23213]
Mouse Orthologue:
Pigw
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class W Gene [Source:MGI Symbol;Acc:MGI:1917575]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16894 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110145 Nonsense 240 424 2 2
ENSDART00000138862 Nonsense 306 490 2 2
Genomic Location (Zv9):
Chromosome 5 (position 4017671)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3677340
GRCz11 5 4010375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGATTTCTCCTGGCAAACAGAGAAGGGGTATTTTCAGTTGTAGGTTA[T/A]ATAGCCATCTACAYGGCTGGYGTTCATGTTGGATGTTACCTCATGCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link