zgc:162318

Ensembl ID:
ENSDARG00000079241
ZFIN ID:
ZDB-GENE-070424-67
Description:
Zgc:162318 protein [Source:UniProtKB/TrEMBL;Acc:A4IG74]
Human Orthologue:
WDR90
Human Description:
WD repeat domain 90 [Source:HGNC Symbol;Acc:26960]
Mouse Orthologue:
Wdr90
Mouse Description:
WD repeat domain 90 Gene [Source:MGI Symbol;Acc:MGI:1921267]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16088 Nonsense Available for shipment Available now
sa30136 Nonsense Mutation detected in F1 DNA During 2018
sa39463 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17731 Nonsense Available for shipment Available now
sa17657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109221 Nonsense 4 1843 1 42
Genomic Location (Zv9):
Chromosome 24 (position 38998271)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37597167
GRCz11 24 37484887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTAGCTGTCAACAGGTRAATCAGATCTRTGAAGTAAACAATGTCTTCC[A/T]AAGGTAAGTTTACCTCTYCAAACTTCACTARTTAAACGGCGAGCMTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109221 Nonsense 363 1843 9 42
Genomic Location (Zv9):
Chromosome 24 (position 39006197)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37605093
GRCz11 24 37492813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATGATGCTGGAGTTCATGTGTATGCTAGCTGTGAGGATGACATCTA[T/A]ATACACACAACAGACAGTGAGGAGGAAATCACAGTAAGTAGAGCTGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109221 Essential Splice Site 374 1843 9 42
Genomic Location (Zv9):
Chromosome 24 (position 39006232)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37605128
GRCz11 24 37492848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGATGACATCTATATACACACAACAGACAGTGAGGAGGAAATCACAG[T/A]AAGTAGAGCTGATACATGAAGATTTAGACCTTCAGTTTAAAGGGCACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109221 Nonsense 593 1843 16 42
Genomic Location (Zv9):
Chromosome 24 (position 39016840)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37615736
GRCz11 24 37503456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGTACGTGGYRGTTCTCTACGCTCTTGYCCTGTGAATTTGGGACAGTA[T/G]CACAATCTGGAGTTCACAGACCTCGCCTTTGAGCAGGGACACACTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109221 Nonsense 970 1843 24 42
Genomic Location (Zv9):
Chromosome 24 (position 39023889)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37622785
GRCz11 24 37510505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCTATTTYATGKTTTTAGTCTGATTATTCCTGTGCTACAGGTCTCT[G/T]AGGTGCACAAGCATCAGTGTGAGTCTCTAGCAGTCAGTGAAGATGSTCAK
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link