si:dkey-253d23.11

Ensembl ID:
ENSDARG00000079236
ZFIN ID:
ZDB-GENE-050208-631
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LWP5]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15861 Nonsense Available for shipment Available now
sa11191 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105930 Nonsense 119 422 2 2
ENSDART00000136404 Nonsense 121 156 3 3
Genomic Location (Zv9):
Chromosome 22 (position 10043023)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9903191
GRCz11 22 9932873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACACACAARTCTTAACTCWCACTGGAAAGAAAGTGTACACMTGTGATT[T/A]ATGTGGGAAGAGTTTTCGTGATCCAAGTACWTTAAAAATCCATCATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105930 Nonsense 199 422 2 2
ENSDART00000136404   None 156 None 3
Genomic Location (Zv9):
Chromosome 22 (position 10042782)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9902950
GRCz11 22 9932632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACAATATGTRAAAATACATGAGAGAATCCACTCTGRAATACAGCCRTA[C/A]ACSTGTGATCAGTGCGGGAAGAGTTTCAAATATAAAAGAGCTCTAGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link