si:dkey-5i22.6

Ensembl ID:
ENSDARG00000079229
ZFIN ID:
ZDB-GENE-070912-571
Description:
si:dkey-5i22.6 [Source:RefSeq peptide;Acc:NP_001108523]
Human Orthologue:
ZNF414
Human Description:
zinc finger protein 414 [Source:HGNC Symbol;Acc:20630]
Mouse Orthologue:
Zfp414
Mouse Description:
zinc finger protein 414 Gene [Source:MGI Symbol;Acc:MGI:1915641]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9142 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17242 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110373 Essential Splice Site 3 331 None 7
ENSDART00000134664 Essential Splice Site 3 119 None 5
Genomic Location (Zv9):
Chromosome 2 (position 22461462)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23348167
GRCz11 2 23003818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGTGATATCSAGTACAGGATTAASTCCCGAAGCAGACATCATGGAGGG[T/C]AWGTCAGCATTACTTCGTCTTCGTTTGATGTTTCAGTRATWATCGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110373 Essential Splice Site 256 331 5 7
ENSDART00000134664   None 119 None 5
Genomic Location (Zv9):
Chromosome 2 (position 22458974)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23345679
GRCz11 2 23001330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTGCCATCTTCRCCAGGATCGAACGCCGTGTGGAGGAAGAATCAAGG[T/A]GAATGGATCTCATAAMACTTTTCTCTGTGAGTGAGGAAAGTCCACTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link