zgc:172140

Ensembl ID:
ENSDARG00000079227
ZFIN ID:
ZDB-GENE-080204-50
Description:
hypothetical protein LOC100136845 [Source:RefSeq peptide;Acc:NP_001108036]
Human Orthologue:
C10orf81
Human Description:
chromosome 10 open reading frame 81 [Source:HGNC Symbol;Acc:26285]
Mouse Orthologue:
9930023K05Rik
Mouse Description:
RIKEN cDNA 9930023K05 gene Gene [Source:MGI Symbol;Acc:MGI:2443041]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17287 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109808 Essential Splice Site 313 331 12 13
ENSDART00000128525 Essential Splice Site 362 380 12 13
Genomic Location (Zv9):
Chromosome 12 (position 32096000)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30402925
GRCz11 12 30517827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGTGGAGGACATACAGCTATACATAAGAAAACTTTCCAAGGGCGAG[G/A]TAATCATGAGTAGATCAATTCTTTCCACTGTRTGATCACAGCTACAGCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link