
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bbs9
- Ensembl ID:
- ENSDARG00000079217
- Human Orthologue:
- BBS9
- Human Description:
- Bardet-Biedl syndrome 9 [Source:HGNC Symbol;Acc:30000]
- Mouse Orthologue:
- Bbs9
- Mouse Description:
- Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14425 | Nonsense | Available for shipment | Available now |
sa18653 | Nonsense | Available for shipment | Available now |
sa22748 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14425
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111308 | Nonsense | 121 | 877 | 4 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 8181604)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 7027336 GRCz11 16 6968014 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTATGGTTTTCTCAGGYACYGCCGGTAATGTTGAAYATGGKGACCAGTA[T/A]CAGCTGCGACTGGTKTATGAACACAACCTGCAGAGAACAGCTTGCAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18653
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111308 | Nonsense | 220 | 877 | 6 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 8186074)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 7031806 GRCz11 16 6972484 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAAATTCAGATACGAGACGCTGGCTGTGGCCACAGATGCAGACACCAAA[C/T]AAGACTCGAATCAGCAAAGCAAGAGCTCAGGAAAAAGACTGACTGTGYGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22748
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111308 | Nonsense | 722 | 877 | 18 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 8267755)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 7113487 GRCz11 16 7054165 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACGCAGCAGAGGACAACCGTGAGCGTTTGATCCAGGCGTTTGCACGTT[T/G]ACGGAGCGCGACTCACCTCCTCATCCTGCTGCTGTCTCTGTGGCAGGGGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Sagittal craniosynostosis: A genome-wide association study identifies susceptibility loci for nonsyndromic sagittal craniosynostosis near BMP2 and within BBS9. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: