wu:fb77e12

Ensembl ID:
ENSDARG00000079148
ZFIN IDs:
ZDB-GENE-030131-1668, ZDB-GENE-090313-304
Human Orthologue:
NCKAP5L
Human Description:
NCK-associated protein 5-like [Source:HGNC Symbol;Acc:29321]
Mouse Orthologue:
Nckap5l
Mouse Description:
NCK-associated protein 5-like Gene [Source:MGI Symbol;Acc:MGI:3609653]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31089 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43983 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24336 Nonsense Available for shipment Available now
sa30740 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Essential Splice Site 25 1275 2 15
ENSDART00000110841 Essential Splice Site 11 1234 2 19
ENSDART00000134978 Essential Splice Site 41 1480 3 12
Genomic Location (Zv9):
Chromosome 23 (position 24939095)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24725215
GRCz11 23 24651756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTACTTTTCTTCCTTGACTTGCTGTTTAAACTGGACTATTTTTGTAT[A/C]GGCAGAGAACTCTGCCCTTTCATTAGCAAACGAGAGTCAGAGAGAAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Essential Splice Site 61 1275 4 15
ENSDART00000110841 Essential Splice Site 47 1234 4 19
ENSDART00000134978 Essential Splice Site 77 1480 5 12
Genomic Location (Zv9):
Chromosome 23 (position 24939584)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24725704
GRCz11 23 24652245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCCATATGTTTTTCAGATGATTTATTTAATATTATGAATTATTCTTTT[A/G]GGATCTCAGAGAGGAATGCATCAAACTGAAAATGCGTGTTTTTGATTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Nonsense 226 1275 6 15
ENSDART00000110841   None 1234 None 19
ENSDART00000134978 Nonsense 236 1480 7 12
Genomic Location (Zv9):
Chromosome 23 (position 24940493)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24726613
GRCz11 23 24653154
KASP Assay ID:
2261-7770.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAATACATCCAGGTGCAATGCACCCAAAGCACATTGTTCCCATTCCTG[T/A]CCAGATGTTTGCACACATCAGCATTTGAATGGAGGAGAGCACAGCAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Nonsense 1032 1275 10 15
ENSDART00000110841 Nonsense 982 1234 13 19
ENSDART00000134978 Nonsense 1215 1480 8 12
Genomic Location (Zv9):
Chromosome 23 (position 24943872)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24729992
GRCz11 23 24656533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCAGACCTGTTTTTAGTCACCAGAGTGCTGCCATTGCTAGTCAGACA[C/T]GAAGCAGTGATGACATGGAAAAGGTAAGTTCAATTCTTTATTGTAGTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link