smarcal1

Ensembl ID:
ENSDARG00000079146
ZFIN ID:
ZDB-GENE-041210-303
Description:
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1
Human Orthologue:
SMARCAL1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 [Sour
Mouse Orthologue:
Smarcal1
Mouse Description:
SWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 Gene [

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34775 Essential Splice Site Available for shipment Available now
sa34776 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038508   None 587 None 25
ENSDART00000112984 Essential Splice Site 348 522 6 10
ENSDART00000122786 Essential Splice Site 251 699 6 18
ENSDART00000127514   None 250 None 13
ENSDART00000136437   None 269 None 4
Genomic Location (Zv9):
Chromosome 9 (position 53954612)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52938824
GRCz11 9 52479727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCACAACTCACACGCAGCCTCATGCCTTTCCAGAGAGACGGAGTCAA[G/A]TACGTTAACTTTAATTTATTGAACAAGTTTGACAAATCGAGATTGCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038508 Essential Splice Site 277 587 10 25
ENSDART00000112984   None 522 None 10
ENSDART00000122786   None 699 None 18
ENSDART00000127514   None 250 None 13
ENSDART00000136437   None 269 None 4
Genomic Location (Zv9):
Chromosome 9 (position 54003072)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52938824
GRCz11 9 52479727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCACAACTCACACGCAGCCTCATGCCTTTCCAGAGAGACGGAGTCAA[G/A]TACGTTAACTTTAATTTATTGAACAAGTTTGACAAATCGAGATTGCAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link