si:ch211-284o19.10

Ensembl ID:
ENSDARG00000079134
ZFIN IDs:
ZDB-GENE-031118-203, ZDB-GENE-070912-284
Human Orthologue:
METT11D1
Human Description:
methyltransferase 11 domain containing 1 [Source:HGNC Symbol;Acc:19280]
Mouse Orthologue:
Mett11d1
Mouse Description:
methyltransferase 11 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1098577]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45112 Nonsense Mutation detected in F1 DNA During 2018
sa31290 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111163 Nonsense 143 464 4 14
ENSDART00000135899 Nonsense 143 294 5 10
ENSDART00000136610 Nonsense 143 441 4 14
ENSDART00000143634 Nonsense 124 184 4 6
Genomic Location (Zv9):
Chromosome 2 (position 37572107)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37851239
GRCz11 2 37833696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACAATTTAGAAGCTCGGATAAGAAAGAAAGTATTATCTGAATTGAGA[A/T]GAACGACATACCACAGAGCTGCCCTAAGGTACACAATCATATGTTTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111163 Essential Splice Site 152 464 4 14
ENSDART00000135899 Essential Splice Site 152 294 5 10
ENSDART00000136610 Essential Splice Site 152 441 4 14
ENSDART00000143634 Essential Splice Site 133 184 4 6
Genomic Location (Zv9):
Chromosome 2 (position 37572078)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37851210
GRCz11 2 37833667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTATTATCTGAATTGAGAAGAACGACATACCACAGAGCTGCCCTAAG[G/A]TACACAATCATATGTTTTCACAGAATGGAGTGCTTGTGTGTTTTATTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link