tmx2a

Ensembl ID:
ENSDARG00000079122
ZFIN ID:
ZDB-GENE-050208-95
Description:
Thioredoxin-related transmembrane protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:A8WG88]
Human Orthologues:
RP11-691N7.7, TMX2
Human Description:
thioredoxin-related transmembrane protein 2 [Source:HGNC Symbol;Acc:30739]
Mouse Orthologue:
Tmx2
Mouse Description:
thioredoxin-related transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1914208]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42388 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109759 Nonsense 124 301 4 8
Genomic Location (Zv9):
Chromosome 14 (position 23117955)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21817671
GRCz11 14 22114916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAATAAAGTGTAATATTTGTTGTTCTTTATTTCTCACTACAGTGTTCT[T/A]GATCACATGTAAACCACCAGCCTACATGGGCCCTGAGAACATCAAATACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link