zgc:114075

Ensembl ID:
ENSDARG00000079116
ZFIN ID:
ZDB-GENE-050913-82
Description:
hypothetical protein LOC619253 [Source:RefSeq peptide;Acc:NP_001028907]
Human Orthologue:
SNX1
Human Description:
sorting nexin 1 [Source:HGNC Symbol;Acc:11172]
Mouse Orthologue:
Snx1
Mouse Description:
sorting nexin 1 Gene [Source:MGI Symbol;Acc:MGI:1928395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38196 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104763 Nonsense 247 484 8 13
Genomic Location (Zv9):
Chromosome Zv9_NA550 (position 6275)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150311.1 6275
GRCz11 KN150311.1 6275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGACTTTTAACATTTAAATTGCCTGTATGTCTGTGATTACTGCAGGTA[T/A]CTACAGAGAGTAGTGGCCCATCCATCTCTACTGCAGGATCCAGATGTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link