zgc:86725

Ensembl ID:
ENSDARG00000079111
ZFIN ID:
ZDB-GENE-040625-46
Description:
actin, beta-like 2 [Source:RefSeq peptide;Acc:NP_001002074]
Human Orthologues:
ACTA1, ACTA2, ACTC1, ACTG2
Human Descriptions:
actin, alpha 1, skeletal muscle [Source:HGNC Symbol;Acc:129]
actin, alpha 2, smooth muscle, aorta [Source:HGNC Symbol;Acc:130]
actin, alpha, cardiac muscle 1 [Source:HGNC Symbol;Acc:143]
actin, gamma 2, smooth muscle, enteric [Source:HGNC Symbol;Acc:145]
Mouse Orthologues:
Acta1, Acta2, Actc1, Actg2
Mouse Descriptions:
actin, alpha 1, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:87902]
actin, alpha 2, smooth muscle, aorta Gene [Source:MGI Symbol;Acc:MGI:87909]
actin, alpha, cardiac muscle 1 Gene [Source:MGI Symbol;Acc:MGI:87905]
actin, gamma 2, smooth muscle, enteric Gene [Source:MGI Symbol;Acc:MGI:104589]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15013 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109883 Nonsense 281 377 8 9
Genomic Location (Zv9):
Chromosome 25 (position 14383723)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14026646
GRCz11 25 14123046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCGTTGTCTGTAGGTATGGAGTCTGCTGGTATTCATGAGACMACTTA[T/A]AACGGCATTATGAAGWGTGACATTGAMATTCGTAAGGATCTGTATGCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link