si:dkey-250j7.4

Ensembl ID:
ENSDARG00000079104
ZFIN ID:
ZDB-GENE-080917-20
Human Orthologue:
MFHAS1
Human Description:
malignant fibrous histiocytoma amplified sequence 1 [Source:HGNC Symbol;Acc:16982]
Mouse Orthologue:
Mfhas1
Mouse Description:
malignant fibrous histiocytoma amplified sequence 1 Gene [Source:MGI Symbol;Acc:MGI:1098644]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43621 Nonsense Mutation detected in F1 DNA During 2018
sa6670 Nonsense Mutation detected in F1 DNA During 2018
sa37281 Nonsense Mutation detected in F1 DNA During 2018
sa37280 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114969 Nonsense 519 994 1 2
ENSDART00000136084 Nonsense 517 964 1 3
Genomic Location (Zv9):
Chromosome 21 (position 18732715)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19868204
GRCz11 21 19904840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTGCATCGTAGGGACCCACAGTGACTTGTGTGAAGAGGTTGAGGTT[G/T]AAGAAAAGTGCCTGGATATTCATAGGCAGATTTCATTTCAGGAAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114969 Nonsense 567 994 1 2
ENSDART00000136084 Nonsense 565 964 1 3
Genomic Location (Zv9):
Chromosome 21 (position 18732569)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19868058
GRCz11 21 19904694
KASP Assay ID:
554-4698.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGAGCAAGGTTATGATGTTCGGACTTCCACCCCCCATGTTCTTTTTTA[T/A]GGGGTCACAGATAAAAACTTGAGACGTAAAAAGTCTCAGTTGCAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114969 Nonsense 666 994 1 2
ENSDART00000136084 Nonsense 664 964 1 3
Genomic Location (Zv9):
Chromosome 21 (position 18732274)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19867763
GRCz11 21 19904399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTTCCTGGTGGGATTCTGCCAGGTTGGGCCTTCAAGCTGGGCTGACA[G/T]AAGACCGCCTGCAAAGTGCGCTCTCTTACCTGCATGAGAGTGGTAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114969 Nonsense 917 994 1 2
ENSDART00000136084 Nonsense 915 964 1 3
Genomic Location (Zv9):
Chromosome 21 (position 18731521)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19867010
GRCz11 21 19903646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGCCAAATATCTGGACAGCTTGGCAAGCCATTATTCCCCTAGTGGAA[G/T]AGTTAAACGTTCTTCTGCAGGAATGGCCTGGCCTTCACTACTCTGTGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link