zgc:154054

Ensembl ID:
ENSDARG00000079103
ZFIN ID:
ZDB-GENE-061103-283
Description:
hypothetical protein LOC777616 [Source:RefSeq peptide;Acc:NP_001071192]
Human Orthologue:
RP11-542P2.1
Human Description:
Glycosyltransferase 54 domain-containing protein [Source:UniProtKB/Swiss-Prot;Acc:A6NG13]
Mouse Orthologue:
4933434I20Rik
Mouse Description:
RIKEN cDNA 4933434I20 gene Gene [Source:MGI Symbol;Acc:MGI:1914805]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13028 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006398 Essential Splice Site 124 430 4 11
Genomic Location (Zv9):
Chromosome 14 (position 52518734)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49890765
GRCz11 14 48878522
KASP Assay ID:
2260-7956.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATCACSAWAGGARGACAAGCTGACACTCRGTTTTAACTGTTCACACA[G/T]TGTCTATGGTGTTCGGCGTGCCCACMGTTCACAGGCAGAAACAGAGTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link