
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-194c3.5
- Ensembl ID:
- ENSDARG00000079056
- ZFIN ID:
- ZDB-GENE-090313-63
- Description:
- hypothetical protein LOC556058 [Source:RefSeq peptide;Acc:NP_001139034]
- Human Orthologue:
- C20orf194
- Human Description:
- chromosome 20 open reading frame 194 [Source:HGNC Symbol;Acc:17721]
- Mouse Orthologue:
- 4930402H24Rik
- Mouse Description:
- RIKEN cDNA 4930402H24 gene Gene [Source:MGI Symbol;Acc:MGI:1923029]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35443 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22248 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35443
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110509 | Nonsense | 484 | 1157 | 17 | 37 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13569788)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13577783 GRCz11 13 13708775 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCTAGGATCAGTAGTTTTCTCTGAATCCTTTCTAGAGTCCAGTGTTTA[C/A]ATTCAGCAGAGAGGTAAAAATAACATAAAATATATATTTTTTATTCAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22248
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110509 | Essential Splice Site | 821 | 1157 | 27 | 37 |
- Genomic Location (Zv9):
- Chromosome 13 (position 13579195)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 13587190 GRCz11 13 13718182 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAGAGAGACAGATATGAACTCATTCAGAGTTGTCCTGCTTATACCAGG[G/A]TATGACAGACACAAACAGTGTGTCCTCAATATACTTAGAGAAAAGTTCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: