si:dkey-85a20.2

Ensembl ID:
ENSDARG00000079055
ZFIN ID:
ZDB-GENE-090313-346
Description:
Novel protein similar to H.sapiens TARBP1, TAR (HIV-1) RNA binding protein 1 (TARBP1) [Source:UniPro
Human Orthologue:
TARBP1
Human Description:
TAR (HIV-1) RNA binding protein 1 [Source:HGNC Symbol;Acc:11568]
Mouse Orthologue:
AC151908.1
Mouse Description:
TAR (HIV-1) RNA binding protein 1 [Source:RefSeq peptide;Acc:NP_001153379]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22365 Nonsense Available for shipment Available now
sa5866 Nonsense Mutation detected in F1 DNA During 2018
sa18458 Nonsense Available for shipment Available now
sa9210 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113259 Nonsense 199 1578 1 29
ENSDART00000132198   None 396 None 10
ENSDART00000133636   None 581 None 13
Genomic Location (Zv9):
Chromosome 13 (position 39837782)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39151883
GRCz11 13 39277773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAAGTCCTGCGGCGAAGATGCTGAATCGGAGGTCCTGCTTCAGATAT[G/A]GGATGATTTATTACGGTGGCATCAGAGAGATCAGACAGATACAGCATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113259 Nonsense 298 1578 2 29
ENSDART00000132198   None 396 None 10
ENSDART00000133636   None 581 None 13
Genomic Location (Zv9):
Chromosome 13 (position 39838161)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39152262
GRCz11 13 39278152
KASP Assay ID:
554-3959.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTRTTTGTTAGTAAACTAGATTTTATTTGGCAGATGAAATCCTGTTC[A/T]KATGGACACCMGATAAACAGAAGCTGCTGAGGGAATTCTGGGAAGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113259 Nonsense 393 1578 4 29
ENSDART00000132198 Nonsense 9 396 1 10
ENSDART00000133636   None 581 None 13
Genomic Location (Zv9):
Chromosome 13 (position 39842510)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39156611
GRCz11 13 39282501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCATCACCTGTTACAGCTGAAAGCRCTGCATCAGCCTGCTTTTGCTT[T/A]GGCCTTTTCACAGGTATCCTTYCTTCCTTCCTTTATTTYTTCCATCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113259 Nonsense 477 1578 7 29
ENSDART00000132198 Nonsense 93 396 4 10
ENSDART00000133636   None 581 None 13
Genomic Location (Zv9):
Chromosome 13 (position 39844751)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39158852
GRCz11 13 39284742
KASP Assay ID:
2260-6834.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGRCAGTGGTGCGCAGTCCCACTGCTCTTTCTGTCCCAGGCCCTGTCCTG[T/A]CTGGCCCCCTGTCCTTTACTGGGAWCTGATGGACTACAGGCRTTCAGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Volumetric brain MRI: Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link