si:dkeyp-68f6.1

Ensembl ID:
ENSDARG00000079049
ZFIN ID:
ZDB-GENE-030131-9787
Human Orthologue:
CERCAM
Human Description:
cerebral endothelial cell adhesion molecule [Source:HGNC Symbol;Acc:23723]
Mouse Orthologue:
Cercam
Mouse Description:
cerebral endothelial cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:2139134]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16759 Nonsense Available for shipment Available now
sa31766 Essential Splice Site Available for shipment Available now
sa9483 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109432 Nonsense 64 591 1 12
Genomic Location (Zv9):
Chromosome 10 (position 10317858)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10393724
GRCz11 10 10351962
KASP Assay ID:
2260-2949.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTACCTCACTACCTTGGTGCCCTCGAAAGATTAAACTATCCCAAGGAG[C/T]GAATCTCTGTCTGGTAGGYKACTTCCCTYTCTGTCGTTTAAGCTTGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109432 Essential Splice Site 298 591 6 12
Genomic Location (Zv9):
Chromosome 10 (position 10326674)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10402540
GRCz11 10 10360778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGGACGATCGCATCAATTTTGTTCACCTTTACCTGGAATCTCTGAG[T/C]GAGTACTTGGACTGCACAATATATCGTTTCAGCATTGATATAGGATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109432 Essential Splice Site 359 591 8 12
Genomic Location (Zv9):
Chromosome 10 (position 10330339)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 10406205
GRCz11 10 10364443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAWGAGCTAGAGATTGATGCTAAAGTTGTGGATGCTATAGATGGAGCG[T/G]AAGTGTGGATGAATRCGCAAGACATGTTCTGYTGTAGTATGACATTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link