wu:fi37d12

Ensembl ID:
ENSDARG00000079046
ZFIN ID:
ZDB-GENE-030131-6174
Human Orthologues:
AP005242.1, C9orf86
Human Description:
chromosome 9 open reading frame 86 [Source:HGNC Symbol;Acc:24703]
Mouse Orthologue:
B230208H17Rik
Mouse Description:
RIKEN cDNA B230208H17 gene Gene [Source:MGI Symbol;Acc:MGI:2442633]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17873 Nonsense Available for shipment Available now
sa2212 Essential Splice Site F2 line generated During 2018
sa33526 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33525 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113716 Nonsense 423 748 10 15
Genomic Location (Zv9):
Chromosome 5 (position 5600877)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5140126
GRCz11 5 5632406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAAAGGTGCAGAGTGTGGATGAATTTGTGCCGGAGGTGGGATTGGAC[C/T]GAACCTTTYTGGATGACGGTGGAGCAGCAGCAGCRGCNNNNNNNNNNNNNNNAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2212
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113716 Essential Splice Site 454 748 11 15
Genomic Location (Zv9):
Chromosome 5 (position 5597593)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5136842
GRCz11 5 5629122
KASP Assay ID:
554-2679.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATTTTGGTCCCGCATTAAACTCATGCAGTTTTCCTGTGTTTTCCTCA[G/A]TGATGGAGAGGGACGGGGAAATCCTCTGGTCTCCGGCTTCCAGGATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113716 Essential Splice Site 520 748 11 15
Genomic Location (Zv9):
Chromosome 5 (position 5597393)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5136642
GRCz11 5 5628922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTCACCAGCAAAAAGCCATCAGCAGCTCAGGACCAAACACAAAGGGG[T/C]AACATAAAAAAAATAAAAGCATCTTAGCAATTCCAGTGTTATGGATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113716 Nonsense 690 748 15 15
Genomic Location (Zv9):
Chromosome 5 (position 5581677)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5120926
GRCz11 5 5613206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGAAATTCTCTTGTTGTTTTAGGAGGATGAGAAAAGCAGCAAAAAA[C/T]GACACAAGCACAAGAAAAAGGAAAAAGAGGAGCCCGGAACGGGAGATGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link