zgc:174573

Ensembl ID:
ENSDARG00000079035
ZFIN ID:
ZDB-GENE-030131-2123
Description:
Wu:fb97d07 protein [Source:UniProtKB/TrEMBL;Acc:A9JT63]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39018 Nonsense Mutation detected in F1 DNA During 2018
sa22563 Nonsense Available for shipment Available now
sa13511 Nonsense Available for shipment Available now
sa12903 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115077 Nonsense 38 338 2 3
Genomic Location (Zv9):
Chromosome 15 (position 840881)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 881184
GRCz11 15 841987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGAGACTGAAGAAGCTTTCAGAGTCAAACATGAAGATCCTGAGCAA[C/T]AAACAGGTTGGTTTTCATCCTCAAAGCTCAACTTTCGATCCTCATTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115077 Nonsense 72 338 3 3
Genomic Location (Zv9):
Chromosome 15 (position 841598)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 881901
GRCz11 15 842704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAATGAAACCAAAGAGGAAAATCAGTGTGAGGAAATTCTTGATTTC[A/T]AATCTGAACAGACAAAAACCTCATCACAAAAAACAGCCAGGAAGACCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115077 Nonsense 115 338 3 3
Genomic Location (Zv9):
Chromosome 15 (position 841727)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 882030
GRCz11 15 842833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTACTTGCAAACAAGGCCTTACATTACATATGAAGATTCACRCTGGA[G/T]AAAGGCATCACACCTGCCAACATTGTRGWAGGAGTTTTACTCGCAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115077 Nonsense 271 338 3 3
Genomic Location (Zv9):
Chromosome 15 (position 842195)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 882498
GRCz11 15 843301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAACRCCKTACACTTGCCAACAGTGTGGAAAGAGTTTTGCTCGAAAA[C/T]AAATCCTTATCGAACATATGTGGATTCACAACGGAGAAAAGCCTTACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link