wu:fi38e01

Ensembl ID:
ENSDARG00000079034
ZFIN ID:
ZDB-GENE-030131-6199
Description:
LOC798996 protein [Source:UniProtKB/TrEMBL;Acc:A9JRE5]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38603 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17140 Nonsense Available for shipment Available now
sa31564 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111719 Essential Splice Site 40 833 3 19
Genomic Location (Zv9):
Chromosome 7 (position 21740068)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20330504
GRCz11 7 20582472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCTGTGTTTGTCTCATTTTTTTATTTTATTTTTTCTCCCCTCCCTA[G/A]TTCCCATTCAGGTGGAGTGCAAGGCCCACTATTTGTTAGTCTCCGTAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111719 Nonsense 205 833 7 19
Genomic Location (Zv9):
Chromosome 7 (position 21738889)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20329325
GRCz11 7 20581293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTAGAGGCCTGGCAGRTTATTCWACAACAAGAGGGACAACRATCC[A/T]AAGTTATGTCAACWGAAGAGGCTGCTTCTCTGGGGTAYACTGTAATGGGM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111719 Essential Splice Site 831 833 18 19
Genomic Location (Zv9):
Chromosome 7 (position 21735421)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20325857
GRCz11 7 20577825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCGTATGGGCCATTTGCGCTGGTCTGAAAACAAGCATTCTCCTAGG[T/C]GACTTGTAACTTTAATTTTCATATTATATTAATTCTAATGACCCATGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link