zgc:171819

Ensembl ID:
ENSDARG00000079020
ZFIN ID:
ZDB-GENE-080204-19
Description:
Zgc:171819 protein [Source:UniProtKB/TrEMBL;Acc:A8KB83]
Human Orthologue:
C2orf3
Human Description:
chromosome 2 open reading frame 3 [Source:HGNC Symbol;Acc:1317]
Mouse Orthologue:
AW146020
Mouse Description:
expressed sequence AW146020 Gene [Source:MGI Symbol;Acc:MGI:2141656]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18029 Essential Splice Site Available for shipment Available now
sa31013 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112559   None 347 None 10
ENSDART00000123399 Essential Splice Site 274 824 4 18
Genomic Location (Zv9):
Chromosome 17 (position 32741843)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32583574
GRCz11 17 32536085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGCACCCAAACCCAAAACTCTGAGAGAGASAATGGCTGAGAAGATGG[G/A]TGAGAAACGWGCACTATTTGTTTATGATAGAACATTCAAATTGGTTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112559   None 347 None 10
ENSDART00000123399 Nonsense 393 824 7 18
Genomic Location (Zv9):
Chromosome 17 (position 32744190)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32585921
GRCz11 17 32538432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAATGCAGATGAGCAGCTCCGATTTTACCGCACCATGAACGTTTTCT[C/A]ACAGAACCTGCTGGAATGCCTATCTGAGAAGGTAATCTTTGTCATTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link