VPS33A (2 of 2)

Ensembl ID:
ENSDARG00000079019
Description:
vacuolar protein sorting 33 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:18179]
Human Orthologue:
VPS33A
Human Description:
vacuolar protein sorting 33 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:18179]
Mouse Orthologue:
Vps33a
Mouse Description:
vacuolar protein sorting 33A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1924823]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18831 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114617 Nonsense 139 595 4 13
Genomic Location (Zv9):
Chromosome 5 (position 72492563)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68853806
GRCz11 5 69626358
KASP Assay ID:
2259-6898.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTGAAGGAGAAAGGCGTCCTGAACTCCTTCACAAACATCGACGAGTA[C/A]ATCCTCGACCTCATCCCTTATGATGGAGATCTGCTTTCCATGGAGTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link