zgc:171581

Ensembl ID:
ENSDARG00000079009
ZFIN ID:
ZDB-GENE-080204-15
Description:
hypothetical protein LOC100136868 [Source:RefSeq peptide;Acc:NP_001108058]
Human Orthologue:
ABCA1
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 1 [Source:HGNC Symbol;Acc:29]
Mouse Orthologue:
Abca1
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 1 Gene [Source:MGI Symbol;Acc:MGI:99607]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42341 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42342 Nonsense Mutation detected in F1 DNA During 2018
sa22420 Nonsense Available for shipment Available now
sa18382 Essential Splice Site Available for shipment Available now
sa16400 Essential Splice Site Available for shipment Available now
sa22421 Essential Splice Site Available for shipment Available now
sa8542 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051556 Essential Splice Site 54 2282 3 46
Genomic Location (Zv9):
Chromosome 14 (position 6410584)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6137971
GRCz11 14 6444698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCCGTCTTCAATGAGGTAGTTAATTTAGTCTCTCTCTATTCATTACA[G/T]GTCACTTTCCCAACAAAGCCATGCCCTCAGCAGGCACCCTGCCCTGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051556 Nonsense 168 2282 5 46
Genomic Location (Zv9):
Chromosome 14 (position 6426079)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6153466
GRCz11 14 6460193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACCCTCTCTACCTTCCTCCTACAAAACGCCTCATTTACAGAGAATTA[T/A]GTTACGAATATTCTGGACGCTGATGTGAATCTTGAAAAGGTGAGAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051556 Nonsense 328 2282 8 46
Genomic Location (Zv9):
Chromosome 14 (position 6439374)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6166761
GRCz11 14 6473488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGACACCCTGAAGGCGGTGGCCTCAAGATCAAATCCCTCAACTGGTA[C/A]GAAGACAGCAACTTCCAGGCGCTGTTTGGCAACCACAACGACAGCGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051556 Essential Splice Site 1728 2282 34 46
ENSDART00000051556 Essential Splice Site 1728 2282 34 46
Genomic Location (Zv9):
Chromosome 14 (position 6460131)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6187518
GRCz11 14 6494245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAATATGCCAAGTATCTAAATGCACATGTCTKTYTGTTTTCTGCTACA[G/T]TGCAATTATGTTGTTCCTGCCACTCTGGTGATCCTGATCTTTGTGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051556 Essential Splice Site 1728 2282 34 46
ENSDART00000051556 Essential Splice Site 1728 2282 34 46
Genomic Location (Zv9):
Chromosome 14 (position 6460131)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6187518
GRCz11 14 6494245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAATATGCCAAGTATCTAAATGCACATGTCTKTYTGTTTTCTGCTACA[G/A]TGCAATTATGTTGTTCCTGCCACTCTGGTGATCCTGATCTTTGTGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051556 Essential Splice Site 1899 2282 37 46
Genomic Location (Zv9):
Chromosome 14 (position 6468142)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6195529
GRCz11 14 6502256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCATTATCACCGTCCTCATCCAGTACAGATTCTTCTTTGAACCCAA[G/T]TAAGCATCATTAACCAATGAAATTATGGATGGAAGTAGTTTCAAAGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051556 Essential Splice Site 2154 2282 44 46
Genomic Location (Zv9):
Chromosome 14 (position 6478135)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6205522
GRCz11 14 6512249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAACGGCAGGTTTCGCTGTCTGGGCAGCGTCCAGCACCTCAAGAACAG[G/A]TAAGACCACTGCTAGTGTGGAGTATCCTAGAGTNNGGGGGGTGGGGGTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)
  • Metabolite levels: Genome-wide association study identifies multiple loci influencing human serum metabolite levels. (View Study)
  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Total ventricular volume: Genome-wide association with MRI atrophy measures as a quantitative trait locus for Alzheimer's disease. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link