TANC2 (2 of 2)

Ensembl ID:
ENSDARG00000079004
Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 [Source:HGNC Symbol;Acc:30212]
Human Orthologue:
TANC2
Human Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 [Source:HGNC Symbol;Acc:30212]
Mouse Orthologue:
Tanc2
Mouse Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38868 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35185 Nonsense Mutation detected in F1 DNA During 2018
sa14210 Essential Splice Site Available for shipment Available now
sa38867 Nonsense Mutation detected in F1 DNA During 2018
sa35184 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45445 Nonsense Mutation detected in F1 DNA During 2018
sa6228 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45444 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Essential Splice Site 218 1720 5 28
Genomic Location (Zv9):
Chromosome 12 (position 3944407)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3238833
GRCz11 12 3350473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTTTAAATGTGTGTGTAATGTGTATTTTTCATGCTGTTTTC[A/G]GTGCGCTTGGCTCCGTATCGACTGCAGGACATCGCTCTGAAGCCGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Nonsense 224 1720 5 28
Genomic Location (Zv9):
Chromosome 12 (position 3944388)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3238814
GRCz11 12 3350454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTAATGTGTATTTTTCATGCTGTTTTCAGTGCGCTTGGCTCCGTAT[C/T]GACTGCAGGACATCGCTCTGAAGCCGCTGCTGTTCGAGGTGCCGAGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Essential Splice Site 312 1720 5 28
Genomic Location (Zv9):
Chromosome 12 (position 3944122)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3238548
GRCz11 12 3350188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCGCATGAGACAGATCGCCTCCGACAGCCCACAGGCATCGCCAAAACG[T/A]GAGATTCACAAGTCCCCTGTCAGACCRAGTGGCACATTNNNCATTCATTCANN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Nonsense 500 1720 9 28
Genomic Location (Zv9):
Chromosome 12 (position 3927207)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3221633
GRCz11 12 3333273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCTTTTCAGGAAATCACCAAACCTCTGCCGTTCCACCAAATCTCTT[T/A]GGACGCTCTGGAGGAAAACGACGCCATCGATCACGACCTGCAAGGCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Essential Splice Site 846 1720 13 28
Genomic Location (Zv9):
Chromosome 12 (position 3922470)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3216896
GRCz11 12 3328536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCCGGACACCTCAGCATCGTCACCTCACTCTGCAAGAGGAAAGCAAAG[G/A]TACACCCGTCTCTGAACTGTAGAGTGGATAATATTTGACTAGAAATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Nonsense 928 1720 16 28
Genomic Location (Zv9):
Chromosome 12 (position 3918969)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3213395
GRCz11 12 3325035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATCTCTTGGACTTGCCTGAGAGGGATGAAGAGGACATTCAACGCGCA[C/T]AGATTAACAGCTGTGACACCCTGTGGGGTGAAACAGGTAAATGAGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Essential Splice Site 939 1720 16 28
Genomic Location (Zv9):
Chromosome 12 (position 3918932)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3213358
GRCz11 12 3324998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCAACGCGCACAGATTAACWGCTGTGACACCCTGTGGGGTGAAACAG[G/A]TAAATGAGMTTWTTTTTCATGCTATRAATKTGTCTCAAGTGACTGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109164 Essential Splice Site 1337 1720 24 28
Genomic Location (Zv9):
Chromosome 12 (position 3910234)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3204660
GRCz11 12 3316300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAACCTGTCCAAGACTTGTTTGAGGATGATGACTTCCTGGAACAAGAG[C/T]TAGAGGCTGTGTCTATTGGTCTTGCTTCTGATATTCGCTCAAACACTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link