zgc:158452

Ensembl ID:
ENSDARG00000079000
ZFIN IDs:
ZDB-GENE-040914-9, ZDB-GENE-070112-2342
Description:
tumor suppressor p53-binding protein 1 [Source:RefSeq peptide;Acc:NP_001073639]
Human Orthologue:
TP53BP1
Human Description:
tumor protein p53 binding protein 1 [Source:HGNC Symbol;Acc:11999]
Mouse Orthologue:
Trp53bp1
Mouse Description:
transformation related protein 53 binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1351320]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34186 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa14524 Nonsense Available for shipment Available now
sa34187 Nonsense Mutation detected in F1 DNA During 2018
sa34188 Nonsense Mutation detected in F1 DNA During 2018
sa21079 Nonsense Available for shipment Available now
sa34189 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109973 Splice Site, Nonsense 192 1709 8 28
ENSDART00000128192 Splice Site, Nonsense 252 1888 10 43
Genomic Location (Zv9):
Chromosome 7 (position 54350746)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52620596
GRCz11 7 52895666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTTTTCCCTTTTTATTTTAAGAATTAAATTGTGTTGGTCTTTTAGGT[C/A]AGAAGTCACTTCAAGCTGTCCTTTAAAGCCTCAGGATGGGGAAAGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109973 Nonsense 273 1709 9 28
ENSDART00000128192 Nonsense 333 1888 11 43
Genomic Location (Zv9):
Chromosome 7 (position 54351326)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52621176
GRCz11 7 52896246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAACATCCACACCTGCACAAAGTCTGCGCCTGCTTCATCTGTCTGGA[C/T]AGGGTACCTATGTACAGGAAAGTCTTTCACAGTAAGTRTTTTAGCCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109973 Nonsense 766 1709 12 28
ENSDART00000128192 Nonsense 826 1888 14 43
Genomic Location (Zv9):
Chromosome 7 (position 54356618)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52626468
GRCz11 7 52901538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGAGTTCAACTAAGGTTTCACCTCTCCGGCTTGAGAAAACCAAATCG[C/T]AGAACACACAGCCAAGTAGTTCAGGACAACAGAAAGTGAACTCAGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109973   None 1709 None 28
ENSDART00000128192 Nonsense 1012 1888 20 43
Genomic Location (Zv9):
Chromosome 7 (position 54365958)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52636039
GRCz11 7 52907362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTCGTGGTGTCTGTGTAGTGAGTTTATCAGACCAGTTCACCCGGCCT[T/G]AAGTTCAGTCTGTTTTCACTCCAAGATGTAAACAATAGTCTGATAATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109973 Nonsense 1008 1709 17 28
ENSDART00000128192 Nonsense 1163 1888 28 43
Genomic Location (Zv9):
Chromosome 7 (position 54372854)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52642845
GRCz11 7 52913970
KASP Assay ID:
2259-9515.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAGAAGCAGATTCTGAAGCTCTGGTCAGCGGTCTGTTATCCCCAGCC[C/T]GAGAACGGGAAGCTCTCGACACTTTTGACAGACCTCAAACACCCGTCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109973 Nonsense 1292 1709 21 28
ENSDART00000128192 Nonsense 1460 1888 34 43
Genomic Location (Zv9):
Chromosome 7 (position 54380545)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52650536
GRCz11 7 52921661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGAACCGTTTCCGCCTTCTGTTTGATGACAACCAGGAGTGTGAAGTG[C/T]AGGGAAAGGACATCTTGCTCTGTGACCCAATTCCTCTGGAGACGGAGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link