si:dkey-48a22.4

Ensembl ID:
ENSDARG00000078981
ZFIN ID:
ZDB-GENE-100922-19
Human Orthologue:
C6orf168
Human Description:
chromosome 6 open reading frame 168 [Source:HGNC Symbol;Acc:20742]
Mouse Orthologue:
6230409E13Rik
Mouse Description:
RIKEN cDNA 6230409E13 gene Gene [Source:MGI Symbol;Acc:MGI:1923382]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32100 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115293 Nonsense 228 403 4 6
ENSDART00000136161 Nonsense 228 399 4 6

The following transcripts of ENSDARG00000078981 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34949712)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32681212
GRCz11 16 32635242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCAGAGGATGCTGGATCTCCCTGGACCCCTCAGTGACCTGCTGAAATG[G/A]ATCCTGTGTCAGCTGACAGGTGGGATGGTAAAAAGAGAGATGTACTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link