si:dkey-256k13.1

Ensembl ID:
ENSDARG00000078973
ZFIN ID:
ZDB-GENE-090311-45
Description:
Uridine kinase [Source:UniProtKB/TrEMBL;Acc:A6H8T1]
Human Orthologue:
UCKL1
Human Description:
uridine-cytidine kinase 1-like 1 [Source:HGNC Symbol;Acc:15938]
Mouse Orthologue:
Uckl1
Mouse Description:
uridine-cytidine kinase 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1915806]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17869 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099903 Essential Splice Site 329 536 9 15
ENSDART00000144386   None 186 None 5
Genomic Location (Zv9):
Chromosome 23 (position 13698259)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 13830192
GRCz11 23 13586269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTTCTGGAAAGCACACCGCAGGTCCGCGGCATGCACACCATCATCAG[G/A]TCAGACATGCACNAATACACATTTATTTATAAAATTACAAATACTTAAAKC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link