rbm15b

Ensembl ID:
ENSDARG00000078966
ZFIN ID:
ZDB-GENE-080204-91
Description:
RNA binding motif protein 15B [Source:RefSeq peptide;Acc:NP_001108062]
Human Orthologue:
RBM15B
Human Description:
RNA binding motif protein 15B [Source:HGNC Symbol;Acc:24303]
Mouse Orthologue:
Rbm15b
Mouse Description:
RNA binding motif protein 15B Gene [Source:MGI Symbol;Acc:MGI:1923598]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44991 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114531 Nonsense 248 402 1 2
ENSDART00000136125 Nonsense 476 630 1 2
Genomic Location (Zv9):
Chromosome 22 (position 35043224)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32282921
GRCz11 22 32237545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGCTGAGAGCCAGGGCTCGCTCTCCCTCACACCCTCTCTTCGCGGAG[C/T]GAGAAAGAGACCGCCTCTCTGAACGGGACTGGAGTCCCCCAAAAGGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link